
I miss those days, now it’s all boring version control
My junior’s commit messages look like this image. There’s always a way.
The Gen Z translation is “Gorilla fr” and “Gorilla frfr”
Is the other species the Western Highland Gorilla(Agorilla gorilla gorilla)?
Edit: it’s not, it’s the Cross River gorilla (Gorilla gorilla diehli) Also, here’s a graphic for y’all to enjoy:

See also: Eurasian Brown Bear (Ursus arctos arctos)
Ursus is Latin for bear and arctos is Greek for…bear.
It’s the bear bear bear!
Bonus fun fact: Arctic means “the place with bears” and Antarctic means “the place without bears”
I think you have it the wrong way around. Ursus is Latin and arctos is Greek.
Oops! I really should be 💯 on it by now since it’s been one of my favorite facts for several years 😄
Anyways, thanks for the correction, I’ll go ahead and edit it 😁
Arctic and Antarctic don’t mean anything about actual bears. They are named after the Ursa Major constellation. The absence of bears in Antarctica is a coincidence.
But isn’t Ursa Major a bear?
no, she’s a major general in the forces, you hippie!
They are, in fact, the very model of a modern major general!
They have information vegetable, animal and mineral!Dammit, beat me by 5 minutes! I tip my hat to you, good sir/madam/other 👌🎩
Lunar’s the loony, I’M the hippie!
Would you say that she’s the very model of a modern Major General, or would that be going too far?
Yes, it means “The great bear” or “The big bear”.
Ursa Major means "the great bear“, though. Being named after something that’s named bear counts in my book as well as those of all but the worst pedants.
The absence of bears in Antarctica is a coincidence.
That’s what the secretly hyper-intelligent penguins who scared away the polar bears WANT you to think!
You’re fucking kidding me
I’m renaming the arctic from now on
Bearritory
If you have a problem with neurodivergent ape namers, please understand that you’re wrong wrong wrong.
“That one to left, that’s the most gorilla that can ever gorilla. Look how hard it’s gorillaing! Name it accordingly.”
OP missed a good opportunity to title this post “goriginallity”
Disgusted slow clap
That’s Grape Ape. I suspect you wanted Magilla Gorilla
nope, purposefully the purple beast. i was goin for the ape consonance

deleted by creator
I mean, just look at 'em
10/10 gorilla
The most gorilla gorilla that ever gorillaed.
Shit, here we go again.
Buffalo buffalo Buffalo buffalo buffalo buffalo Buffalo buffalo.
Gorilla gorilla, Gorilla gorilla gorilla, gorilla Gorilla gorilla
Ignoring capitalisation you can add as many buffalos as you like and still be parsable. I’ve only ever heard buffalo used as a verb in this one context, though, so seems a bit forced to me
The scuttlebutt is that buffalo as a verb was only attested very briefly in upstate New York and the Midwest for a brief period of time in the early 1900s. It never spread nationally, and definitely not internationally.
However, checking Google ngrams shows that “he buffaloed” and “was buffaloed”, (to ensure it’s being used idiomatically as a verb and not just in the famous example sentence) emerged in 1900, peaked in the 1950s, but has sustained small but constant use in published print since then. I was actually expecting the ngram to rapidly drop off and never recover… shocked to see that some people still use it as a real phrase.
You’re doing the lord’s work
For a long time humans were classified as homo sapien sapien
Wait, they took one of our sapiens? The bastards!
Not that I’ve heard of. Now, whether Homo sapiens idaltu is a real separate species from Homo sapiens sapiens is disputed, so there’s a question as to whether the second sapiens actually differentiates us from anything… but I haven’t seen any signs of any consensus against calling ourselves Homo sapiens sapiens to date.
That’s how gorillas pronounce their name
some one tell him about Buffalo
Maybe at some point we’ll have version control for all DNA mapping so each minor change is a commit hash and each major release is a tag
We do, the major versions have tag releases like mm7, mm8, mm9, etc. as defined by the current build, and minor patch releases too like mm10p14 as new sequences come in.
https://hgdownload.cse.ucsc.edu/goldenpath/mm10/bigZips/
Example, say you have 5 sequences: CAT, ATC, ATCG, CGT, and ATATA.
One way of combining them up together to build a transcriptome is like this:
5 sequences: ATATA CG-T ATC ATCG CAT Reference: ATCGATATATCATCGATATATC isn’t the only solution to these sequences, but as you get more sequences to try and overlap, the more the uncertainty goes down
That’s really interesting, thanks for sharing













